[protocols] annotate-seqs.py Gives not hit

[Guddu Khan]

Hi,
I followed the protocol in given link
http://khmer-protocols.readthedocs.org/en/latest/mrnaseq/6-annotating-transcript-families.html

After running this command

annotate-seqs.py trinity-nematostella.renamed.fa nema.x.mouse.ortho
nema.x.mouse.homol

I got following output as below, Also pasted the first few lines from
each output file.

(khmerEnv)q at dx4-biotek12:~/Software/Annotation$
./eel-pond-master/annotate-seqs.py trinity-nematostella.renamed.fa
nema.x.mouse.ortho nema.x.mouse.homol
Scanning sequences -- first pass to gather info
... 0
... 25000
... 50000
... 75000
... 100000
... 125000
... 150000
... 175000
... 200000
second pass: annotating
... x2 0
... x2 25000
... x2 50000
... x2 75000
... x2 100000
... x2 125000
... x2 150000
... x2 175000
... x2 200000
----
207533 sequences total
0 annotated / ortho
0 annotated / homol
0 annotated / tr
0 total annotated

annotated sequences in FASTA format: trinity-nematostella.renamed.fa.annot
annotation spreadsheet in: trinity-nematostella.renamed.fa.annot.csv
annotation spreadsheet with sequences (warning: LARGE):
trinity-nematostella.renamed.fa.annot.large.csv




*less*
*trinity-nematostella.renamed.fa.annot*>nema.id1.tr89018
1_of_1_in_tr89018 len=261 id=1 tr=89018
CAGCCTTTAGAAGGAAACAGTGGCAATATATAATTCTAGATGAAGCTCAGAATATCAAAAATTTTAAAAGTCAAAGGTGGCAGTTGCTGTTGAATTTTTCAAGTCAGAGGAGACTTTTGTTGACTGGAACACCTTTGCAGAACAATTTGATGGAGCTGTGGTCGCTTATGCATTTCCTCATGCCATCAATGTTTGCTTCTCATAAAGATTTTAGGGAGTGGTTTTCTAACCCTGTTACAGGGATGATTGAAGGGAATTCAG
>nema.id2.tr459575 1_of_1_in_tr459575 len=217 id=2 tr=459575
GCCAGTTGCAAACACGAATTTCAATCCATTAACATTTCATGAGTTGGAATCTCCACAGAAACTTTCTTTTCATCACGACCCCTGTTCCAAATGATTCCTTTCACACAAAACTGACCGGACAGGAAACAGAAAAAACAAGCAAGGGTCATGCAATAGACGACTTATTACCGGAAACCGCGATATTTAGCCAAGACATAAGTGCAAATTAAAACATCGA
>nema.id3.tr219232 1_of_1_in_tr219232 len=252 id=3 tr=219232



*less trinity-nematostella.renamed.fa.annot.csv*
sequence name,unique ID,Transcript family,ortholog,homology
score,homolog,family orthology,family homology,additional information
nema.id1.tr89018 1_of_1_in_tr89018 len=261 id=1 tr=89018,id1,tr89018
1_of_1_in_tr89018 len=261 id=1 tr=89018,,,,,,
nema.id2.tr459575 1_of_1_in_tr459575 len=217 id=2
tr=459575,id2,tr459575 1_of_1_in_tr459575 len=217 id=2 tr=459575,,,,,,
nema.id3.tr219232 1_of_1_in_tr219232 len=252 id=3
tr=219232,id3,tr219232 1_of_1_in_tr219232 len=252 id=3 tr=219232,,,,,,
nema.id4.tr355712 1_of_1_in_tr355712 len=226 id=4
tr=355712,id4,tr355712 1_of_1_in_tr355712 len=226 id=4 tr=355712,,,,,,
nema.id5.tr222444 1_of_1_in_tr222444 len=252 id=5
tr=222444,id5,tr222444 1_of_1_in_tr222444 len=252 id=5 tr=222444,,,,,,

*less trinity-nematostella.renamed.fa.annot.large.csv*
sequence name,unique ID,Transcript family,ortholog,homology
score,homolog,family orthology,family homology,additional
information,sequence
nema.id1.tr89018 1_of_1_in_tr89018 len=261 id=1 tr=89018,id1,tr89018
1_of_1_in_tr89018 len=261 id=1
tr=89018,,,,,,,CAGCCTTTAGAAGGAAACAGTGGCAATATATAATTCTAGATGAAGCTCAGAATATCAAAAATTTTAAAAGTCAAAGGTGGCAGTTGCTGTTGAATTTTTCAAGTCAGAGGAGACTTTTGTTGACTGGAACACCTTTGCAGAACAATTTGATGGAGCTGTGGTCGCTTATGCATTTCCTCATGCCATCAATGTTTGCTTCTCATAAAGATTTTAGGGAGTGGTTTTCTAACCCTGTTACAGGGATGATTGAAGGGAATTCAG




Regards

Imran Khan
Research Scholar,
University of Porto
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://lists.idyll.org/pipermail/protocols/attachments/20160209/105e7331/attachment.htm>