<div dir="ltr">I don't know if this helps, but: the command is not responding to Ctrl-c or kill -9 as root.<br></div><div class="gmail_extra"><br clear="all"><div><div dir="ltr"><br>--<br>Daniel S. Standage<br>Ph.D. Candidate<br>Computational Genome Science Laboratory<br>Indiana University<br></div></div>
<br><div class="gmail_quote">On Wed, Sep 17, 2014 at 4:38 PM, Daniel Standage <span dir="ltr"><<a href="mailto:daniel.standage@gmail.com" target="_blank">daniel.standage@gmail.com</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex"><div dir="ltr"><div>Here it is: <a href="https://gist.github.com/standage/4222de94bd695f23f673" target="_blank">https://gist.github.com/standage/4222de94bd695f23f673</a><br><br></div>Forgot to mention, running khmer 1.1<br><br>Thanks,<br>Daniel<br></div><div class="gmail_extra"><span class=""><br clear="all"><div><div dir="ltr"><br>--<br>Daniel S. Standage<br>Ph.D. Candidate<br>Computational Genome Science Laboratory<br>Indiana University<br></div></div>
<br></span><div><div class="h5"><div class="gmail_quote">On Wed, Sep 17, 2014 at 4:31 PM, C. Titus Brown <span dir="ltr"><<a href="mailto:ctb@msu.edu" target="_blank">ctb@msu.edu</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">On Wed, Sep 17, 2014 at 04:27:09PM -0400, Daniel Standage wrote:<br>
> Before running norm-by-median, I<br>
><br>
> - Downloaded SRA file<br>
> - Used fastq-dump to create paired Fastq files<br>
> - used interleave-reads to create a Fastq file in the One True Format<br>
<span>><br>
> All of the Fastq files seem to be fine i.e. none appear truncated. Memory<br>
> usage is remaining constant, CPU utilization is 100%, but the weird thing<br>
> is that as far as I can tell the norm-by-median script is complete. It has<br>
> processed all the input, given a final report, and all of the kept reads<br>
> have been written to output: except the last read is missing and the second<br>
> to last read is cut off.<br>
<br>
</span>Sounds like a classic fencepost error :(.<br>
<br>
Could you send me (on or off the list) the SRA commands you used and<br>
the command line you ran with diginorm? Then we'll see if we can replicate<br>
on our own hardware.<br>
<br>
cheers,<br>
<div><div>--titus<br>
<br>
> On Wed, Sep 17, 2014 at 4:21 PM, C. Titus Brown <<a href="mailto:ctb@msu.edu" target="_blank">ctb@msu.edu</a>> wrote:<br>
><br>
> > Hi Daniel,<br>
> ><br>
> > sounds like an infinite loop of some sort :(.<br>
> ><br>
> > A few questions --<br>
> ><br>
> > What version of khmer are you using?<br>
> ><br>
> > Have you run the reads file through any other software? I'm worried<br>
> > that the file is truncated in some way.<br>
> ><br>
> > Do you know how far through your reads file it's gotten?<br>
> ><br>
> > Is memory usage increasing or remaining constant?<br>
> ><br>
> > thanks,<br>
> > --titus<br>
> ><br>
> > On Wed, Sep 17, 2014 at 04:16:37PM -0400, Daniel Standage wrote:<br>
> > > Hi all,<br>
> > ><br>
> > > I am seeing some strange behavior running normalize-by-median.py. The<br>
> > > program seemed to complete successfully after 30-45 minutes, but then it<br>
> > > just hung there. It's now been at least 90 minutes and it's continuing to<br>
> > > hang. The output file seems to contain all the data except the last<br>
> > record,<br>
> > > and the second-to-last record is cut off.<br>
> > ><br>
> > > (khmer-env)[standage@bggnomic qc] tail SRR494178_int.fastq.keep<br>
> > > +<br>
> > ><br>
> > GBGED>>E##################################################################################<br>
> > > @SRR494178.12090255/1<br>
> > ><br>
> > TCGAGGACNACCTTTTGACCCTTCTGCAACCTTTGAATTTCAGACATCAAACTCTCCCTCTGTCGTGTCTCCNNCAATGATGGGTCGGGC<br>
> > > +<br>
> > ><br>
> > IIIIIGGG#GGGGGGIIIIIIIIIIIIIIIIGIHIIIIIGIIIIIIIIIIIIIHIIIIHIEGHHIFIHII=?##?;9>>;IGBFFGBD8G<br>
> > > @SRR494178.12090255/2<br>
> > ><br>
> > GATTCCGTCACCGAGGAGTATCCGTTGCCGAGGTTGTGCGTCTGTCGAACCTGGCCGTTCTTTTTGACCGTGTAGGTGCCGCCGTTGATC<br>
> > > +<br>
> > > IIIIIIHIIIIIIIIIBIHHIIIGIIIIIII(khmer-env)[standage@bggnomic qc]<br>
> > ><br>
> > > Any ideas as to what could be causing this?<br>
> > ><br>
> > > Thanks,<br>
> > > Daniel<br>
> > ><br>
> > > PS.<br>
> > ><br>
> > > - OS: Fedora 20 with lots o RAM (100s of GB)<br>
> > > - Command: normalize-by-median.py -k 17 -p -N 4 -x 8e9<br>
> > > SRR494178_int.fastq<br>
> > > - Data: <a href="http://www.ncbi.nlm.nih.gov/sra/?term=SRR494178" target="_blank">http://www.ncbi.nlm.nih.gov/sra/?term=SRR494178</a><br>
> > ><br>
> > ><br>
> > > --<br>
> > > Daniel S. Standage<br>
> > > Ph.D. Candidate<br>
> > > Computational Genome Science Laboratory<br>
> > > Indiana University<br>
> ><br>
> > > _______________________________________________<br>
> > > khmer mailing list<br>
> ><br>
> > --<br>
> > C. Titus Brown, <a href="mailto:ctb@msu.edu" target="_blank">ctb@msu.edu</a><br>
> ><br>
<br>
--<br>
C. Titus Brown, <a href="mailto:ctb@msu.edu" target="_blank">ctb@msu.edu</a><br>
</div></div></blockquote></div><br></div></div></div>
</blockquote></div><br></div>