<div dir="ltr"><div>Before running norm-by-median, I<br><ul><li>Downloaded SRA file</li><li>Used fastq-dump to create paired Fastq files</li><li>used interleave-reads to create a Fastq file in the One True Format</li></ul></div>All of the Fastq files seem to be fine i.e. none appear truncated. Memory usage is remaining constant, CPU utilization is 100%, but the weird thing is that as far as I can tell the norm-by-median script is complete. It has processed all the input, given a final report, and all of the kept reads have been written to output: except the last read is missing and the second to last read is cut off.<br></div><div class="gmail_extra"><br clear="all"><div><div dir="ltr"><br>--<br>Daniel S. Standage<br>Ph.D. Candidate<br>Computational Genome Science Laboratory<br>Indiana University<br></div></div>
<br><div class="gmail_quote">On Wed, Sep 17, 2014 at 4:21 PM, C. Titus Brown <span dir="ltr"><<a href="mailto:ctb@msu.edu" target="_blank">ctb@msu.edu</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">Hi Daniel,<br>
<br>
sounds like an infinite loop of some sort :(.<br>
<br>
A few questions --<br>
<br>
What version of khmer are you using?<br>
<br>
Have you run the reads file through any other software? I'm worried<br>
that the file is truncated in some way.<br>
<br>
Do you know how far through your reads file it's gotten?<br>
<br>
Is memory usage increasing or remaining constant?<br>
<br>
thanks,<br>
--titus<br>
<span class=""><br>
On Wed, Sep 17, 2014 at 04:16:37PM -0400, Daniel Standage wrote:<br>
> Hi all,<br>
><br>
> I am seeing some strange behavior running normalize-by-median.py. The<br>
> program seemed to complete successfully after 30-45 minutes, but then it<br>
> just hung there. It's now been at least 90 minutes and it's continuing to<br>
> hang. The output file seems to contain all the data except the last record,<br>
> and the second-to-last record is cut off.<br>
><br>
> (khmer-env)[standage@bggnomic qc] tail SRR494178_int.fastq.keep<br>
> +<br>
> GBGED>>E##################################################################################<br>
> @SRR494178.12090255/1<br>
> TCGAGGACNACCTTTTGACCCTTCTGCAACCTTTGAATTTCAGACATCAAACTCTCCCTCTGTCGTGTCTCCNNCAATGATGGGTCGGGC<br>
> +<br>
> IIIIIGGG#GGGGGGIIIIIIIIIIIIIIIIGIHIIIIIGIIIIIIIIIIIIIHIIIIHIEGHHIFIHII=?##?;9>>;IGBFFGBD8G<br>
> @SRR494178.12090255/2<br>
> GATTCCGTCACCGAGGAGTATCCGTTGCCGAGGTTGTGCGTCTGTCGAACCTGGCCGTTCTTTTTGACCGTGTAGGTGCCGCCGTTGATC<br>
> +<br>
> IIIIIIHIIIIIIIIIBIHHIIIGIIIIIII(khmer-env)[standage@bggnomic qc]<br>
><br>
> Any ideas as to what could be causing this?<br>
><br>
> Thanks,<br>
> Daniel<br>
><br>
> PS.<br>
><br>
</span>> - OS: Fedora 20 with lots o RAM (100s of GB)<br>
> - Command: normalize-by-median.py -k 17 -p -N 4 -x 8e9<br>
> SRR494178_int.fastq<br>
> - Data: <a href="http://www.ncbi.nlm.nih.gov/sra/?term=SRR494178" target="_blank">http://www.ncbi.nlm.nih.gov/sra/?term=SRR494178</a><br>
<span class="">><br>
><br>
> --<br>
> Daniel S. Standage<br>
> Ph.D. Candidate<br>
> Computational Genome Science Laboratory<br>
> Indiana University<br>
<br>
</span>> _______________________________________________<br>
> khmer mailing list<br>
<span class="HOEnZb"><font color="#888888"><br>
--<br>
C. Titus Brown, <a href="mailto:ctb@msu.edu">ctb@msu.edu</a><br>
</font></span></blockquote></div><br></div>