[khmer] normalize-by-median.py Hanging

[C. Titus Brown]

Hi Daniel,

sounds like an infinite loop of some sort :(.

A few questions --

What version of khmer are you using?

Have you run the reads file through any other software?  I'm worried
that the file is truncated in some way.

Do you know how far through your reads file it's gotten?

Is memory usage increasing or remaining constant?

thanks,
--titus

On Wed, Sep 17, 2014 at 04:16:37PM -0400, Daniel Standage wrote:
> Hi all,
> 
> I am seeing some strange behavior running normalize-by-median.py. The
> program seemed to complete successfully after 30-45 minutes, but then it
> just hung there. It's now been at least 90 minutes and it's continuing to
> hang. The output file seems to contain all the data except the last record,
> and the second-to-last record is cut off.
> 
> (khmer-env)[standage at bggnomic qc] tail SRR494178_int.fastq.keep
> +
> GBGED>>E##################################################################################
> @SRR494178.12090255/1
> TCGAGGACNACCTTTTGACCCTTCTGCAACCTTTGAATTTCAGACATCAAACTCTCCCTCTGTCGTGTCTCCNNCAATGATGGGTCGGGC
> +
> IIIIIGGG#GGGGGGIIIIIIIIIIIIIIIIGIHIIIIIGIIIIIIIIIIIIIHIIIIHIEGHHIFIHII=?##?;9>>;IGBFFGBD8G
> @SRR494178.12090255/2
> GATTCCGTCACCGAGGAGTATCCGTTGCCGAGGTTGTGCGTCTGTCGAACCTGGCCGTTCTTTTTGACCGTGTAGGTGCCGCCGTTGATC
> +
> IIIIIIHIIIIIIIIIBIHHIIIGIIIIIII(khmer-env)[standage at bggnomic qc]
> 
> Any ideas as to what could be causing this?
> 
> Thanks,
> Daniel
> 
> PS.
> 
>    - OS: Fedora 20 with lots o RAM (100s of GB)
>    - Command: normalize-by-median.py -k 17 -p -N 4 -x 8e9
>    SRR494178_int.fastq
>    - Data: http://www.ncbi.nlm.nih.gov/sra/?term=SRR494178
> 
> 
> --
> Daniel S. Standage
> Ph.D. Candidate
> Computational Genome Science Laboratory
> Indiana University

> _______________________________________________
> khmer mailing list

-- 
C. Titus Brown, ctb at msu.edu