[khmer] filter-below-abund.py fastq scores from previous file
C. Titus Brown
ctb at msu.edu
Sun Apr 21 11:58:58 PDT 2013
On Sun, Apr 21, 2013 at 09:03:10AM +0300, Jens-Konrad Preem wrote:
> OK. Filter below abund working as expected :) producing a fastq output.
> Problem was with Python, made a new khmer in new virtualenv.
> Thank you for your patience :D.
Exellent, glad you could solve it easily!
cheers,
--titus
> On 04/20/2013 05:26 PM, C. Titus Brown wrote:
>> On Sat, Apr 20, 2013 at 09:21:04AM +0300, Jens-Konrad Preem wrote:
>>> OK. The filter-below-abund.py from sandbox did not produce an fastq file
>>> (from a fastq file foo.fastq.keep, it produced fasta file
>>> foo.fastq.keep.below),
>>> The khmer was built at 19th of April with git clone
>>> git://github.com/ged-lab/khmer.git*, and make clean all. Havent checked
>>> filter abund yet.
>>> Jens
>>> *should clone the master branch? (Not much of git user)
>> Yes, that should have worked. How disappointing :)
>>
>> The updates were to python/khmer/thread_utils.py; for example, see line
>> 168:
>>
>> https://github.com/ged-lab/khmer/blob/master/python/khmer/thread_utils.py#L168
>>
>> My first guess is that maybe you have multiple versions of khmer lying
>> around, or some such; could you try
>>
>> import khmer
>> print khmer
>>
>> inside of Python, and make sure that the source file from 'khmer' is loaded
>> is from the right place to have been checked out? You may need to modify
>> your PYTHONPATH to get things to work right.
>>
>> I've added a test for the FASTQ output that is now on master, too;
>> look for test_filter_abund_3() in tests/test_scripts.py.
>>
>> Whether or not the PYTHONPATH is your particular problem, I think now that more
>> people are using khmer, we should start talking about doing installation
>> better; I still prefer to use it out of a build directory, but I'm a developer
>> :). I'll file an issue (now #47).
>>
>> Here's what I just did:
>>
>> ---
>> git clone https://github.com/ged-lab/khmer.git
>> cd khmer
>> make clean all test
>> export PYTHONPATH=./python/
>> python scripts/load-into-counting.py 25k data/25k.fq.gz
>> python scripts/filter-abund.py 25k data/25k.fq.gz
>> head -4 25k.fq.gz.abundfilt
>> ---
>>
>> the output of the last command is:
>>
>> @895:1:1:1264:15854/1
>> CGTGATGATGTGCTTGCGGCCGGAGGGCCTGT
>> +
>> ``W__ZZ__ZSOJNNNQWSQZ\^X\W__
>>
>> So it can, at least on one person's computer, work :)
>>
>> And, Jens, thanks for your patience!
>>
>> cheers,
>> --titus
>>
>>> On 04/19/2013 07:24 PM, C. Titus Brown wrote:
>>>> On Fri, Apr 19, 2013 at 12:14:48PM +0300, Jens-Konrad Preem wrote:
>>>>> On 04/17/2013 07:21 AM, C. Titus Brown wrote:
>>>>>> I have hacked this into ged-lab/master branch for filter-abund and
>>>>>> filter-below-abund. Let me know if it works (or doesn't work!)
>>>>>>
>>>>>> cheers,
>>>>>> --titus
>>>>>>
>>>>> So if I clone and build from the git page, those two scripts should now
>>>>> put out fastq as their output?
>>>> Yes.
>>>>
>>>>> Or do they need some extra tags at the start time?.
>>>> Nope.
>>>>
>>>>> As a note - the sandbox scripts do not have the #!/usr/bin/env python
>>>>> line and also need to be chmod +x in addition to this to be started.
>>>>> Don't know if it is so as some thought out design issue/feature or not,
>>>>> anyway thought I'd mention it.
>>>> Thanks for pointing this out!
>>>>
>>>> --t
>>> --
>>> Jens-Konrad Preem, MSc, University of Tartu
>>>
>
> --
> Jens-Konrad Preem, MSc, University of Tartu
>
--
C. Titus Brown, ctb at msu.edu
More information about the khmer
mailing list