[khmer] filter-below-abund.py fastq scores from previous file
Jens-Konrad Preem
jpreem at ut.ee
Sat Apr 20 23:03:10 PDT 2013
OK. Filter below abund working as expected :) producing a fastq output.
Problem was with Python, made a new khmer in new virtualenv.
Thank you for your patience :D.
Jens
On 04/20/2013 05:26 PM, C. Titus Brown wrote:
> On Sat, Apr 20, 2013 at 09:21:04AM +0300, Jens-Konrad Preem wrote:
>> OK. The filter-below-abund.py from sandbox did not produce an fastq file
>> (from a fastq file foo.fastq.keep, it produced fasta file
>> foo.fastq.keep.below),
>> The khmer was built at 19th of April with git clone
>> git://github.com/ged-lab/khmer.git*, and make clean all. Havent checked
>> filter abund yet.
>> Jens
>> *should clone the master branch? (Not much of git user)
> Yes, that should have worked. How disappointing :)
>
> The updates were to python/khmer/thread_utils.py; for example, see line
> 168:
>
> https://github.com/ged-lab/khmer/blob/master/python/khmer/thread_utils.py#L168
>
> My first guess is that maybe you have multiple versions of khmer lying
> around, or some such; could you try
>
> import khmer
> print khmer
>
> inside of Python, and make sure that the source file from 'khmer' is loaded
> is from the right place to have been checked out? You may need to modify
> your PYTHONPATH to get things to work right.
>
> I've added a test for the FASTQ output that is now on master, too;
> look for test_filter_abund_3() in tests/test_scripts.py.
>
> Whether or not the PYTHONPATH is your particular problem, I think now that more
> people are using khmer, we should start talking about doing installation
> better; I still prefer to use it out of a build directory, but I'm a developer
> :). I'll file an issue (now #47).
>
> Here's what I just did:
>
> ---
> git clone https://github.com/ged-lab/khmer.git
> cd khmer
> make clean all test
> export PYTHONPATH=./python/
> python scripts/load-into-counting.py 25k data/25k.fq.gz
> python scripts/filter-abund.py 25k data/25k.fq.gz
> head -4 25k.fq.gz.abundfilt
> ---
>
> the output of the last command is:
>
> @895:1:1:1264:15854/1
> CGTGATGATGTGCTTGCGGCCGGAGGGCCTGT
> +
> ``W__ZZ__ZSOJNNNQWSQZ\^X\W__
>
> So it can, at least on one person's computer, work :)
>
> And, Jens, thanks for your patience!
>
> cheers,
> --titus
>
>> On 04/19/2013 07:24 PM, C. Titus Brown wrote:
>>> On Fri, Apr 19, 2013 at 12:14:48PM +0300, Jens-Konrad Preem wrote:
>>>> On 04/17/2013 07:21 AM, C. Titus Brown wrote:
>>>>> I have hacked this into ged-lab/master branch for filter-abund and
>>>>> filter-below-abund. Let me know if it works (or doesn't work!)
>>>>>
>>>>> cheers,
>>>>> --titus
>>>>>
>>>> So if I clone and build from the git page, those two scripts should now
>>>> put out fastq as their output?
>>> Yes.
>>>
>>>> Or do they need some extra tags at the start time?.
>>> Nope.
>>>
>>>> As a note - the sandbox scripts do not have the #!/usr/bin/env python
>>>> line and also need to be chmod +x in addition to this to be started.
>>>> Don't know if it is so as some thought out design issue/feature or not,
>>>> anyway thought I'd mention it.
>>> Thanks for pointing this out!
>>>
>>> --t
>> --
>> Jens-Konrad Preem, MSc, University of Tartu
>>
--
Jens-Konrad Preem, MSc, University of Tartu
More information about the khmer
mailing list